Purple Hearts
Main menu
Home
English
Scopo del sito
Mappa del sito
ID in pillole
Links
Ricerca
Libri stranieri
Libri italiani
Documenti
Contatto
Administrator
Login
Username

Password

Remember me
Forgotten your password?

RSS

La termodinamica smentisce Darwin - Thermodynamics disproves Darwin
Redazione - Staff  

English version

Introduzione
La termodinamica è la branca della fisica che studia le leggi che governano la conversione dell'energia da una forma all'altra, e la disponibilità dell'energia a produrre lavoro. La termodinamica statistica per studiare tali problemi deve considerare i sistemi come composti da un numero talmente grande di elementi che possono essere modellati solo con metodi statistici. La teoria biologica dell'evoluzione è un'ipotesi che cerca di spiegare l'origine della vita e delle specie solo grazie a spiegazioni naturali. Cosa c'entra la termodinamica con la teoria biologica dell'evoluzione. Come funziona l'entropia nei sistemi fisici e in quelli biologici? Che relazioni esistono tra la termodinamica e la teoria dell'informazione? In questo articolo cercheremo di fare alcune considerazioni elementari al riguardo. La teoria evolutiva ha due principali assunti. Primo, essa sostiene l'abiogenesi (cioè l'origine spontanea della vita dalla materia inorganica); secondo, essa sostiene la macroevoluzione Darwiniana (cioè la trasformazione di tutte le specie a partire da un unico antenato comune), per mezzo delle mutazioni casuali e della selezione naturale. Noi cercheremo di spiegare semplicemente come le leggi della termodinamica e dell'entropia confutano le ipotesi evolutive.
Entropia termodinamica
Secondo la termodinamica, un processo in un sistema chiuso, non può finire con la stessa energia utile che aveva in partenza, perché una parte va sempre persa in calore. Se consideriamo il calore una forma di energia, la prima legge della termodinamica, detta anche "della conservazione dell'energia", stabilisce che in un sistema chiuso l'energia rimane costante, attraverso tutte le trasformazioni che essa può subire. La seconda legge della termodinamica (SLOT = Second Law Of Termodynamics), che è stata anche chiamata "principio dell'entropia termodinamica", statuisce che in un sistema chiuso l'entropia aumenta (o al massimo rimane costante). In pratica l'entropia, che è una misura direttamente proporzionale al grado di disordine, non fa che aumentare a tutti i livelli di organizzazione dell'universo.
Per strano che possa sembrare la preistoria della scoperta dei principi entropici va ricercata nell'ambito del calcolo delle probabilità. Questa branca della matematica nacque con lo studio dei giochi d'azzardo. A.De Moivre, cercando di caratterizzare un gioco d'azzardo, introdusse nel calcolo delle probabilità, il concetto di "incertezza media" del risultato sommando le incertezze pesate dei singoli risultati. L'incertezza di un risultato è definita come il logaritmo naturale dell'inverso della probabilità dello stesso di verificarsi.
In modo analogo il fisico L.Boltzmann in termodinamica definisce l'entropia "S" di un sistema statistico (esempio un gas) come S = k log W; dove "k" è una costante moltiplicativa (detta di Boltzmann) e "W" è il numero di configurazioni possibili dello stato in oggetto. Considerato che "W" è l'inverso della probabilità di verificarsi dello stato, la formula di Boltzmann, è simile a quella di De Moivre a meno della costante moltiplicativa "k". La formula è logaritmica perché le probabilità si moltiplicano mentre le entropie si sommano. L'entropia è quindi una grandezza che definisce la probabilità di un certo stato di un gas, oppure di un sistema il cui numero di elementi è tale da essere intrattabile se non con mezzi statistici.
L'entropia è in relazione all'incertezza di un risultato o stato. La SLOT afferma che un gas (o in generale un sistema fisico complesso) si porta sempre verso gli stati più probabili, ovvero verso l'aumento dell'entropia. Si pensi a due serbatoi, denominati A e B, contenenti un gas a temperature diverse. In queste condizioni il sistema ha un certo grado d'ordine, tant'è vero che ha la potenzialità di produrre lavoro, grazie alla differenza termica; l'informazione è massima (due temperature). Se rendiamo comunicanti i due serbatoi le temperature si uniformano ad un valore medio perché le molecole lente si mescolano a quelle veloci; aumenta il grado di disordine; non è più possibile ricavare lavoro; si perde informazione (una sola temperatura).I fisici hanno dapprima trovato difficile conciliare la visione deterministica, reversibile e la visione probabilistica, irreversibile. E` stato infatti a partire dalla scoperta delle leggi della termodinamica che la visione semplicistica della fisica classica, contraddistinta dalla dinamica deterministica e reversibile dei sistemi stabili, ha iniziato a entrare in crisi, fino a condurre alla constatazione che: «Persino a livello macroscopico la nostra predizione del futuro mescola insieme determinismo e probabilità»[1].
Vediamo se è possibile rendersi conto di questa transizione di concezioni, o meglio coesistenza di concezioni, riprendendo l'esempio dei due recipienti. Ipotizziamo, come caso limite, che i due recipienti contengano un'unica molecola, dotata di velocità media costante. Questa molecola, che all'inizio si trova nel recipiente A, a causa del suo moto, può spostarsi nel recipiente B. Niente impedisce però che, dopo un certo tempo, essa ritorni in A, e così via indefinitamente. Ad ogni istante c'è la stessa probabilità che la molecola si trovi in A oppure in B. La sua traiettoria deterministica è calcolabile con le leggi della dinamica classica, ed è reversibile. Immaginiamo invece ora che nel serbatoio A ci sia un numero molto grande di molecole con la stessa velocità. Dopo un certo tempo le molecole si saranno divise metà in A e metà in B. Le loro traiettorie non sono (umanamente) calcolabili con la dinamica classica, lo stato raggiunto è descrivibile solo statisticamente ed è irreversibile. Siamo passati da una descrizione deterministica ad una descrizione statistica per la quale vale la seconda legge della termodinamica, la legge dell'irreversibilità e della "freccia del tempo". Bisogna notare che non è il fenomeno in sé ad essere indeterministico. L'indeterminismo è solo apparente: semplicemente non essendo noi in grado di calcolare effettivamente tutte le innumerevoli traiettorie ci dobbiamo accontentare di una descrizione probabilistica.
L'irreversibilità invece è reale. Non dipende dalle nostre limitazioni. Da cosa è nata? Per saperlo chiediamoci cosa è cambiato. E` cambiato solo il numero delle molecole: si è passati da una molecola a molte molecole. Ecco dimostrato che la seconda legge della termodinamica, quella dell'entropia, è una delle conseguenze del principio cosmologico secondo il quale il processo cosmico è irreversibile perché va dall'unità alla molteplicità, dall'Essenza alla Sostanza.
Ogni processo che causa aumento dell'entropia è irreversibile. Le conseguenze sono varie: il calore passa da un corpo caldo a uno freddo e non viceversa; l'energia passa da forme maggiormente pregiate a quelle meno pregiate e non viceversa, l'ordine degrada in disordine in modo irreversibile, ogni cosa si usura, l'informazione si corrompe. Si può dire intuitivamente che gli stati ordinati sono pochi mentre quelli disordinati sono molti, per cui essendo più probabile il disordine, la tendenza è inevitabilmente verso di esso, piuttosto che verso l'ordine. Nelle macchine di qualsiasi tipo, ovvero in sistemi dove ci sono parti in movimento, quest'ultimo crea calore e usura entrambi irreversibili. Ci sono mille esempi nella vita pratica di deriva verso il disordine. L'esempio classico più banale è quello del dado che si svita dal suo bullone a causa delle vibrazioni: una volta svitato non si rimonta da solo e si richiede l'intervento umano.
Il diavoletto di Maxwell
J.C.Maxwell, lo scopritore delle equazioni dell'elettromagnetismo, per illustrare il concetto dell'entropia e le sue implicazioni, ricorreva al seguente famoso esempio ideale. Immaginiamo che i soliti due serbatoi comunicanti A e B contengano un gas alla stessa temperatura e pressione. Immaginiamo inoltre che il condotto posto fra i due sia dotato di una porticina apribile presidiata da un "diavoletto" la cui funzione sia questa: quando vede arrivare una molecola da A a forte velocità la fa passare in B; invece se arriva una molecola a bassa velocità la trattiene in A lasciando chiusa lo sportello. E` evidente che a lungo andare B conterrà solo molecole ad alta energia cinetica e quindi sarà più caldo ed A solo molecole a bassa temperatura e quindi sarà più freddo. Tale differenza di temperatura potrebbe essere sfruttata per creare lavoro. Il diavoletto di Maxwell smentisce dunque il secondo principio della termodinamica ed è in grado di diminuire l'entropia?
La risposta è decisamente "no", per questo motivo: tale diavoletto è un dispositivo ideale che, a ben guardare, svolge un lavoro molto complesso. Realizzare in pratica un dispositivo siffatto significherebbe progettare un sistema che consuma energia ed elabora informazione. Infatti si tratterebbe probabilmente di introdurre fra i due serbatoi un complesso sistema computerizzato. Calcolando la somma algebrica delle energie entranti e uscenti del sistema inteso nella sua globalità (serbatoi + dispositivo) vedremmo che né il primo né il secondo principio della termodinamica sarebbero smentiti. Questo esempio ideale ha però il pregio di introdurre nelle questioni termodinamiche il concetto di informazione. Per questo motivo l'abbiamo citato. La principale funzione di questo dispositivo dovrebbe essere la conoscenza dell'informazione sulle velocità delle molecole. Solo in questo modo sarebbe possibile controbilanciare l'entropia. Il diavoletto di Maxwell ci insegna che solo elaborando informazione sarebbe possibile "organizzare" un sistema statistico come è un gas. Quindi la "morale" del diavoletto di Maxwell è molto importante perché congiunge la termodinamica con la teoria dell'informazione. Come dice giustamente Dembsky: «E` la CSI che permetterebbe al diavoletto di Maxwell di gestire un sistema termodinamico tendente all'equilibrio»[2].
In verità ciò si può generalizzare tout court: solo l'informazione può organizzare un sistema qualsiasi. Si vede quindi come fra tutti questi concetti esistano delle profonde relazioni. Infatti sia l'entropia termodinamica che l'informazione sono in relazione alle probabilità degli stati che un sistema statistico, o in generale un sistema dotato di molti elementi, può assumere. La probabilità è alla base di entrambi i concetti e questa constatazione quindi ci conduce direttamente a parlare ora dell'entropia dell'informazione.
Informazione ed entropia
E‘ utile fare quindi una digressione per tratteggiare le relazioni che intercorrono fra l'entropia fisica di cui sopra e quella informatica. Intuitivamente l'informazione è ciò che diminuisce l'incertezza. La mancanza di informazione si traduce in disordine. L'entropia esprime il disordine di un sistema. Quindi l'entropia può misurare la mancanza di informazione. Matematicamente il contenuto di informazione digitale I in bits di uno stato (o evento, o sequenza di simboli, pattern) è definito come I = log (1/P) (dove P è la probabilità del pattern e "log" è il logaritmo in base 2) (C.Shannon[3]). Questa formula è simile a quella dell'entropia termodinamica, perché entrambi i concetti sono in relazione a probabilità di stati in grandi spazi degli eventi. L.Brillouin esprime così una relazione tra informazione ed entropia: ΔS ≥ ΔS -k * ln 2 * ΔI  ≥ 0, che è una specie di SLOT[4] generalizzata. Secondo la Teoria Algoritmica dell'Informazione (AIT) la complessità algoritmica K(d) di una stringa (pattern) di dati ‘d' è la più concisa descrizione di ‘d' (o il minimo algoritmo che genera ‘d'). Cosicché la termodinamica incontra l'AIT nella seguente definizione:
 
«L'entropia fisica S(d) = K(d)+ H(d) è la somma di due contributi: (i) la casualità algoritmica K(d), e (ii) l'informazione che è ancora mancante circa il micro-stato attuale, a dispetto della disponibilità di ‘d'[i dati già disponibili circa il sistema], misurata dall'entropia condizionata di Shannon H(d).»[5]
 
Alcune interessanti conseguenze derivano da questa relazione tra l'entropia dell'informazione e quella fisica. In un sistema per far diminuire l'entropia bisogna che venga iniettata in esso informazione. Ogni volta che si perde informazione il processo è irreversibile.
 

«Si può interpretare l'entropia come mancanza di informazione sul sistema considerato. [...] L'entropia è considerata in generale come espressione del disordine di un sistema fisico. Più precisamente, si può dire che l'entropia misura la mancanza di informazione sulla strutture effettiva del sistema. Questa mancanza di informazione implica la possibilità di una grande varietà di strutture microscopiche diverse che sono, in pratica, impossibili da distinguere le une dalle altre. Poiché una qualunque di queste strutture può esistere realmente a un istante dato, la mancanza di informazione corrisponde ad un disordine reale. [...] L'entropia è una misura della mancanza di informazione [...] più grande è l'informazione, più piccola sarà l'entropia. [...] risulta dunque possibile diminuire l'entropia di un sistema aumentando l'informazione»[6].

 
Il concetto di informazione e della sua entropia è strettamente in relazione al grado di organizzazione di un sistema. Come N.Wiener ha scritto: «La quantità di informazione in un sistema è una misura del suo grado di organizzazione»[7]. L'aumento dell'entropia di informazione in un sistema provoca sempre disorganizzazione e degrado nel suo funzionamento. Inoltre essendo i sistemi biologici dei sistemi dinamici adattativi massimamente complessi non lineari la relazione che lega il delta di entropia con i suoi effetti non è lineare essa stessa. Vale in altre parole ciò che succede in matematica e in informatica: anche un piccolo errore nell'informazione causale iniziale può provocare enormi danni negli effetti.
Per il secondo principio della termodinamica in un sistema l'energia degrada in modo irreversibile e, da tutto ciò che abbiamo detto, deriva che, per il "principio dell'entropia informatica", anche l'informazione subisce lo stesso destino, cioè degrada. Solo iniettando in un sistema informazione dall'esterno è possibile contrastare l'entropia e il disordine. Per questo motivo nella teoria della trasmissione dati si studiano sistemi per contrastare il degrado dell'informazione sui vettori di trasmissione. A causa di tale degrado (di cui l'entropia è una misura), causato da vari fattori, non c'è alcuna garanzia che l'informazione arrivi corretta al destinatario. Opportuni algoritmi e tecniche di codificazione sono stati studiati per aumentare la ridondanza dell'informazione, ovvero contrastare l'entropia, e quindi far si che l'informazione arrivi intatta alla destinazione. Senza questi algoritmi, di rigenerazione continua dell'informazione, le telecomunicazioni sarebbero impossibili.
L'entropia in biologia
Abbiamo visto come l'entropia funziona nella scienza e nella tecnologia. Cosa succede in biologia? Qui ci troviamo di fronte ad una situazione paradossale. Riguardo all'origine della vita l'evoluzionismo, affermando che è sorta spontaneamente (abiogenesi), dice praticamente che l'informazione biologica, l'organizzazione e l'ordine sono sorti dal nulla. Ciò contraddice l'entropia. Inoltre il Neo-Darwinismo pretende che le specie si siano evolute continuamente da forme semplici a forme sempre più complesse. Di nuovo ciò contraddice l'entropia.
L'evoluzionismo affermando che la vita si è sviluppata da sola, dice praticamente che in un sistema è nata informazione e quindi organizzazione e ordine dal nulla. Dicendo che la vita evolve da forme meno complesse a forme più complesse afferma inoltre che l'informazione e l'organizzazione crescono spontaneamente. In questo modo va inesorabilmente contro il secondo principio della termodinamica, inteso sia sotto il suo aspetto fisico che sotto l'aspetto informatico. E' come se dicesse che il calore passa spontaneamente da un corpo freddo a uno caldo, oppure che togliere informazione ad un sistema ne aumenta l'organizzazione, o che mettendo una mela sana in un cesto di mele marce, codeste diventano sane.
Le leggi dell'entropia stabiliscono senza ombra di dubbio che tutto, e da sempre, in natura procede dall'ordine al disordine, se non interviene l'intelligenza. L'evoluzionismo pretende invece che dal disordine sia nato l'ordine, anzi l'ordine al suo massimo grado, la colossale organizzazione della vita. La sua pretesa è in assoluta contraddizione con queste leggi. Le difese che gli evoluzionisti tentano contro i principi dell'entropia, letali per la loro teoria, sono, e non possono non esserlo, inconsistenti. Esamineremo qui tre delle loro argomentazioni difensive per sfuggire all'inesorabile tendenza entropica che mina alla base le loro ipotesi, fornendo per ognuna le spiegazioni del caso.
Primo errore: l'energia non può produrre informazione.
Come primo tentativo di difesa (alle critiche degli anti-evoluzionisti basate sui principi dell'entropia) gli evoluzionisti fanno notare[8] che gli organismi ricevono continuamente energia dal sole la quale produce ordine e informazione.
Qui si intravede una confusione fra il vettore o supporto dell'informazione e l'informazione stessa, che sono due cose ben diverse. Facciamo un esempio: una linea telegrafica può funzionare solo grazie all'energia elettrica ma il messaggio che transita sulla linea deve essere introdotto dal telegrafista. Quest'ultimo introduce l'informazione e l'energia elettrica svolge la funzione del suo trasporto.
Bisogna distinguere fra il concetto di ordine energetico e il concetto di ordine informatico. Abbiamo visto che, a causa dell'entropia termodinamica, l'energia degrada irreversibilmente in qualità, passa cioè da forme più ordinate a forme meno ordinate. Il calore è la forma più degradata di energia in quanto l'agitazione molecolare è quanto di più caotico si possa immaginare. Una corrente elettrica che passa in un conduttore è una forma di energia più pregiata: consiste in un flusso di elettroni che vanno tutti nella stessa direzione. Ma quest'ordine fisico maggiore che abbiamo chiamato ordine energetico è di ordine diverso dall'ordine informatico. L'ordine informatico è sempre, in casi simili, in ultimissima analisi riconducibile ad un rigoroso ordine di bit. Si pensi al flusso di informazione telegrafica di cui sopra: il messaggio scritto dal telegrafista è, volendo, raffigurabile come una sequenza di bit, che viaggiano come un trenino sulla linea telegrafica. Per fare un esempio banale: abbiamo un bel da illuminare e riscaldare una stanza, ma se non ci decidiamo a metterla in ordine, la stanza rimane sempre disordinata!
La questione può essere vista anche in quest'altro modo. Il perpetuarsi della vita in tutti gli esseri viventi richiede una quantità inimmaginabile di processi retroazionati, metabolici, costruttivi, di eliminazione, di trasformazione, di riparazione, di duplicazione, di controllo e via dicendo. Tutti questi processi vitali omeostatici, grazie ai quali, in una parola, è mantenuto l'ordine e l'equilibrio a tutti i livelli di organizzazione negli organismi, consumano energia. Solo da questo punto di vista si può dire che l'ordine richiede anche energia. Senza energia tutti questi processi si fermano. Ma l'energia da sola non è affatto sufficiente a creare e mantenere l'ordine biologico. L'energia alimenta soltanto i numerosissimi meccanismi biologici che garantiscono l'organizzazione. Senza l'opera intelligente e incessante di questi ultimi, che contrastano la degenerazione, la vita non potrebbe mantenersi un istante di più, anche in presenza di energia. Pensare che l'energia solare possa, da sola, giustificare in toto l'organizzazione della vita è assurdo:
«Un motore può funzionare spontaneamente; ma non si costruisce da solo spontaneamente. Prendiamo pure i pezzi che lo costituiscono (e ancor peggio, prendiamo pure i semplici materiali di cui è formato); se li lasciamo abbandonati, anche se in presenza di una qualsivoglia forma di energia come ad esempio quella dei raggi del sole, non è possibile che essi si ordinino spontaneamente a formare il motore»[9].
Per contestare questo esempio del motore gli evoluzionisti non possono trovare la scusa che un motore non è fatto di materia biologica perché sono loro stessi a dire che la materia organica è esattamente uguale a quella inorganica. In definitiva l'illusione che basti l'energia per creare organizzazione è dovuta alla ignoranza della complementarità fra energia e materia da una parte e informazione dall'altra, i primi rappresentando la Sostanza e la seconda l'Essenza del cosmo.
Come replica alle nostre obiezioni i Darwiniani potrebbero citare gli esperimenti di S.Miller. Miller per provare sperimentalmente la nascita della vita a partire da sostanze chimiche inorganiche cercò di simulare il cosiddetto "brodo primordiale". Pose dentro un'ampolla metano, ammoniaca, vapore acqueo e idrogeno e fornì energia al sistema tramite scariche elettriche. Dopo una settimana Miller fece l'analisi chimica del composto e trovó che si erano formati spontaneamente alcuni aminoacidi. Molti altri esperimenti furono fatti per cercare di ottenere spontaneamente le proteine che sono molto più complesse ma senza successo:
«Gli scienziati si chiedono: "come ha potuto la vita evolversi a partire dalla materia inanimata? e qual è la probabilità di un simile evento?" Per loro grande dispiacere, queste domande non hanno risposte precise, dal momento che i chimici non sono mai riusciti a riprodurre gli esperimenti della natura sulla creazione della vita a partire dalla materia non vivente»[10].
Materia più energia da soli non possono dare l'informazione e l'ordine contenuti anche negli unicellulari più semplici. Gli aminoacidi che sono stati prodotti nell'esperimento di Miller sono i normali aminoacidi che c'è da aspettarsi dalle reazioni chimiche possibili a partire dai composti chimici immessi nell'ampolla.
C'è inoltre un'ulteriore difficoltà da tenere in conto: le molecole di aminoacidi possono esistere in natura in due tipi simmetrici di configurazione: levogira (luce polarizzata a sinistra) o destrogira (luce polarizzata a destra). Negli esperimenti di sintesi degli aminoacidi, come in quello di Miller, come è giusto, si formano statisticamente il cinquanta per cento degli uni e il cinquanta per cento degli altri. Si da il caso che, per motivi inspiegabili o meglio tuttora sconosciuti, negli organismi tutti gli aminoacidi, quindi tutte le proteine e gli acidi nucleici, sono levogiri:
«Ma come potrebbero i milioni di gradini del DNA essere tutti, senza eccezione, asimmetrici dallo stesso lato, se la loro scelta è stata effettuata a caso tra materiali metà levogiri e metà destrogiri? Crederemmo al caso se una roulette facesse uscire per secoli solo il rosso e mai il nero?»[11].
Basterebbe questa constatazione da sola per confutare ogni ipotesi di abiogenesi.
Seconde errore: l'evoluzione non può produrre informazione.
Come seconda cosa ricordano che tali principi valgono per i sistemi chiusi e gli organismi sono immersi in un ambiente che, secondo loro, gli fornisce informazione, tramite l'adattamento e la selezione naturale.
In realtà nei fenomeni adattativi e selettivi non c'è neanche un infinitesimo dell'iniezione di informazione necessaria per le trasformazioni miracolose che hanno in mente gli evoluzionisti. Semplicemente l'ambiente favorisce variazioni limitate di possibilità, già presenti negli organismi. Quindi c'è una differenza abissale fra una specie che si adatta ad un certo ambiente e un organismo che, come sostengono loro, si evolva, per mezzo di una metamorfosi impensabile, verso un organismo completamente diverso, appartenente addirittura ad un altro ordine o classe.
Invece gli evoluzionisti, cercando di spiegare l'evoluzione dal rettile all'uccello, dicono qualcosa di simile:
«Persino dove sorgono degli organi destinati a funzioni nuove, ad esempio delle ali per volare, essi si sviluppano in base allo stesso principio, per «trasformazione», cosicché le ali nascono dalle zampe anteriori dei rettili»[12].
Analoga la spiegazione dell'evoluzione dei pesci in anfibi e poi in rettili. I pesci erano stufi dell'umidità e volevano finalmente stare un po' all'asciutto, risultato: gli sono spuntati degli arti:
«La comparsa dei vertebrati tetrapodi e la loro meravigliosa espansione, affermatasi con gli anfibi, i rettili, gli uccelli e i mammiferi, trae proprio origine dal fatto che un pesce primitivo scelse di andare ad esplorare la terra, sulla quale era però incapace di spostarsi se non saltellando in modo maldestro e creando così, come conseguenza di una modificazione di comportamento, la pressione selettiva grazie alla quale si sarebbero sviluppati gli arti robusti dei tetrapodi»[13].
L'evoluzionismo prevede anche la direzione inversa, dalla terra al mare: i cetacei infatti sarebbero mammiferi quadrupedi terrestri che erano stufi della terraferma. Questa strana bidirezionalità evolutiva suggerisce che molto probabilmente tutti gli animali sono sempre rimasti tranquillamente nel loro habitat naturale per il quale sono stati progettati!
La derivazione dell'uomo dalle scimmie antropomorfe in fondo è stata meno spettacolare e un po' deludente al confronto. E' bastato che questi animali imparassero a camminare in posizione eretta:
«Se alcuni primati non avessero acquisito la postura eretta, la nostra genealogia sarebbe probabilmente terminata in un gruppo di scimmie antropomorfe»[14].
L'informazione occorrente al supposto trasformismo non c'è, o meglio non la può dare l'evoluzione. L'ambiente seleziona ma non da l'informazione necessaria al trasformismo.
Gli evoluzionisti si sono chiesti se nel loro processo evolutivo (mutazione + selezione) ci sia aumento di informazione. In quale dei due fattori si può trovare il generatore di informazione? Ricordiamo che l'informazione è ciò che riduce l'incertezza. A questa domanda risponde Dawkins, un'autorità in campo evoluzionistico:
«La mutazione non è un incremento nel vero contenuto informativo, ma è piuttosto il contrario, dato che la mutazione, nell'analogia di Shannon, contribuisce ad aumentare l'incertezza precedente. Ma ora veniamo alla selezione naturale, la quale riduce l'"incertezza precedente" e pertanto, fornisce un contributo informativo al pool genetico. [...] Se la selezione naturale fornisce informazione al pool genico, di che tipo di informazione si tratta? Si tratta dell'informazione su come sopravvivere»[15].
Quindi la mutazione non inietta informazione e la selezione naturale si può dire che fornisca solo l'informazione per la sopravvivenza. Ma fornire la modesta informazione "su come sopravvivere" ad un rettile è la stessa cosa di fornirgli l'immensa CSI (informazione complessa specificata) necessaria per "trasformarlo" in un uccello? Sicuramente no. Analogamente dare un soldo ad un mendicante, può permettergli forse di sostentarsi oggi, ma non lo trasforma di certo, come per incanto, in un re! Allo stesso modo che le elemosine non bastano ad evitare che la gente muoia di fame, così l'informazione "su come sopravvivere" non è bastata ad evitare che il 99 per cento delle specie si siano estinte nel corso delle ere geologiche. 
I Darwinisti sottolineano che, delle sue due componenti, mutazione e selezione, la mutazione è casuale ma la selezione è un algoritmo, cioè una legge. Se ci fosse soltanto la mutazione casuale ci sarebbe poco da dire: abbiamo visto all'inizio che il caso è impotente a progettare. Dire, come è stato detto sopra da Dawkins, che la mutazione non crea informazione è praticamente la stessa cosa. Ma è grazie alla presenza della selezione che l'evoluzionismo funzionerebbe. La mutazione è solo il "motore" che produce la variazione in ingresso all'algoritmo di selezione. Bisogna, per prima cosa, dire che questo motore è inefficiente (perlomeno allo scopo di incentivare la macroevoluzione), in quanto le variazioni che genera possono dar luogo al massimo alla microevoluzione. In quanto alla selezione è un algoritmo il cui scopo è semplicemente di ottimizzare la funzione di fitness. Come detto sopra la legge selettiva non ha altro scopo che far sopravvivere. Un meccanismo che è stato progettato per questo determinato scopo - diciamo di "minima" - non può dar luogo, per il principio di causalità, ad un risultato di tutt'altro ordine, un risultato qualitativamente incomparabile con il primo, la macroevoluzione. A nulla vale dire che ciò si otterrebbe con il gradualismo, ovvero con piccoli incrementi successivi.
In definitiva, la selezione naturale non può operare se non trasformazioni minime negli organismi.
Terzo errore: eventi neghentropici non possono causare evoluzione.
Il terzo tentativo per scansare il colpo inferto alla loro teoria dall'entropia è quello, fra gli altri, di J.Monod[16] che fa notare come l'entropia sia un concetto statistico. In quanto tale possono verificarsi nello spazio-tempo dei rarissimi casi in cui l'entropia invece di aumentare diminuisce. Sarebbe in questi fuggevoli istanti che l'evoluzione opera tramite la selezione naturale. I fisici fanno l'esempio di un mattone: se in un istante particolare l'entropia diminuisse al punto che tutte le molecole fossero direzionate verso l'alto, il mattone si solleverebbe nell'aria da solo. Non è matematicamente impossibile, cioè la probabilità dell'evento non è esattamente zero.
Francamente basare l'evoluzione intera sulla rarità di questi fenomeni mi sembra a dir poco ottimista: molto più ottimista di un uomo, che pur non sapendo nuotare, si tuffasse lo stesso in mare da una nave sperando che un'onda anomala sufficientemente potente lo risollevasse sulla tolda.
Un esempio di calcolo effettivo di un simile fenomeno di "neghentropia" - o entropia negativa - in biologia, è dato da G.Nicolis e I.Prigogine:
«Consideriamo la formazione di una proteina lunga 100 aminoacidi (ρ = 100). In natura ci sono 20 tipi diversi di aminoacidi (N =20). Se la biopolimerizzazione avvenisse in un sistema isolato nel quale tutte le sequenze sono a priori equiprobabili, avremmo N = exp(100 ln 20) ~ exp(300) sequenze equiprobabili. Quindi, qualsiasi specifica configurazione necessaria ad ottenere una certa funzione biologica avrebbe una probabilità eccezionalmente bassa di exp(-300). Se la biopolimerizzazione avviene in condizioni di non equilibrio corrispondenti ad un'entropia di, poniamo I = 0.1 Imax, allora solo n ~ exp(30) sequenze di lunghezza 100 sarebbero realizzate con probabilità apprezzabile. Questo numero è più abbordabile. E` quindi concepibile che l'evoluzione agendo su una popolazione così ristretta in un ambiente non in equilibrio possa produrre, dato tempo sufficiente, entità dotate di proprietà speciali come l'auto-riproduzione, efficiente scambio energetico, e così via»[17].
Ammettiamo pure che una probabilità su 10.686 miliardi possa considerarsi attuabile. Prima di tutto sembra gratuita l'assunzione che l'entropia diventi un decimo: I = 0.1 Imax. Ma, pur concedendo anche questo, si tratterebbe solo della formazione casuale di una proteina per una cellula. Da lì ad arrivare a "entità dotate di proprietà speciali come l'auto-riproduzione, efficiente scambio energetico, e così via", cioè alle cellule c'è un bel salto! Ricordiamo, per fare un esempio, che una cellula di Escherichia Coli, il comune batterio intestinale, senza considerare l'acqua, contiene in media 332 milioni di molecole, di cui 1 milione di molecole proteiche (di 3000 tipi diversi)[18]. Il batterio, per avere solo la sua dotazione proteica (non parliamo del resto) dovrebbe aspettare addirittura un milione di eventi entropici miracolosi? No, risponde il citologo, perché al suo interno c'è una fabbrica di proteine. Ma così il problema si complica ulteriormente ed enormemente: dalla formazione spontanea di una proteina si passa alla formazione spontanea di una fabbrica di proteine (capace di produrne un milione di 3000 tipi differenti!). Di quanti ordini di grandezza è aumentata la complessità del problema? Capirete che stiamo percorrendo una scala dell'assurdo sempre più ripida. Succede sempre così quando l'evoluzionismo cerca di spiegare la formazione casuale della prima cellula.
La freccia del tempo
I.Prigogine scrisse: "Il più importante contributo della termodinamica è il famoso secondo principio, che introduce in fisica la freccia del tempo"[19]. La termodinamica mostra che in sistema l'entropia cresce globalmente, ovvero in qualsiasi processo la tendenza dell'entropia è crescente. L'asimmetria dell'entropia è in relazione all'asimmetria del tempo, ovvero in ogni processo il tempo è irreversibile. Per questo motivo nessun processo può andare indietro nel tempo. Secondo la termodinamica un processo non guidato è una specie di passaggio dall'ordine al disordine. In un sistema l'entropia cresce perché gli stati disordinati sono molto più numerosi di quelli ordinati. Essendo maggiore il numero degli stati disordinati è più grande la loro probabilità di verificarsi. Essendo minore il numero degli stati ordinati è più piccola la loro probabilità di verificarsi. Siccome i sistemi vanno sempre verso i loro stati più probabili (quelli disordinati) l'entropia cresce. Più disordine più entropia. La SLOT, considerando l'universo come un sistema, afferma che esso va verso la sua "morte termica", il suo stato più disordinato e probabile (quella dell'entropia massima). In questo senso l'universo è una specie di "discesa" dall'ordine al disordine. La tipica obiezione è: ma il sorgere della civiltà, della scienza e della tecnologia sembrano provare il contrario. Questa obiezione dimentica semplicemente che ogni manifestazione di ordine, conoscenza e organizzazione necessità di intelligenza. La termodinamica si occupa solo di processi senza l'apporto dell'intelligenza.
Nel cosmo uno spazio veramente vuoto non esiste perché lo spazio contiene sempre corpi; analogamente il tempo vuoto non esiste perché il tempo contiene sempre eventi. Gli eventi comportano processi fisici. I processi fisici comportano la crescita dell'entropia. La crescita dell'entropia introduce l'irreversibilità. Siccome il tempo non esiste senza eventi (ed entropia ed irreversibilità) il tempo è legato all'entropia ed è esso stesso irreversibile. Esempio: un corpo è mosso dal punto A (tempo 1) al punto B (tempo 2). Quindi ritorna dal punto B (tempo 3) al punto A (tempo 4). Cosa è successo? Ora il corpo è di nuovo in A ma la situazione al tempo 4 non è affatto identica alla situazione al tempo 1. In generale nel cosmo ci possono essere situazioni simili ma mai identiche. Infatti nel processo A->B->A l'entropia è cresciuta ed il tempo è passato. Tutto ciò ha un nome: irreversibilità. L'asimmetria del tempo è legata all'entropia e alle altre asimmetrie del cosmo.
La termodinamica afferma che in un processo fisico non guidato l'ordine diminuisce e il disordine aumenta. Potremmo chiederci: ci sono relazioni fra la termodinamica e i due principi cosmologici chiamati "qualità" e "quantità"? Il legame con il binomio qualità e quantità è basato sulla corrispondenza tra qualità => ordine e tra quantità => disordine. Per capirlo semplicemente pensate, per esempio, ad un edificio. Un architetto progetta una casa e i muratori la costruiscono usando dei materiali. A questo punto abbiamo il massimo ordine (la qualità è al suo massimo e la quantità al minimo - la casa può essere considerata un unico sistema organizzato e strutturato). Noi sappiamo che senza una manutenzione continua l'azione distruttiva di molti fattori ambientali col tempo disgregherà la casa riducendola ad un mucchio di macerie. Allora avremo il massimo disordine (la qualità è al suo minimo e la quantità al massimo - ci saranno solo più molti piccoli pezzi). Qualcuno potrebbe obiettare che anche la casa è fatta di molti pezzi. Ma questa obiezione viene da un punto di vista riduzionistico e positivistico. Da un punto di vista più profondo la casa deve considerarsi come un tutto organizzato. L'universo è analogo a quella casa e la termodinamica ci dice che l'entropia lavora nello stesso modo in entrambi i casi. Potremmo dire che nel cosmo il ruolo della qualità è di ordinare la quantità (ovvero l'informazione ordina la materia e l'energia). Naturalmente questo è anche il ruolo del progettista rispetto ai suoi progetti.
Nessuno ha mai visto l'origine spontanea della vita o la macroevoluzione per la semplice ragione che entrambi non sono mai accaduti. Non si sono verificati per la semplice ragione che essi richiedono informazione ed energia. Ma codeste sono sottomesse alle implacabili leggi della termodinamica. L'entropia non fa sconti a nessuno e niente. Per concludere è un vero paradosso che l'evoluzionismo, che pretende di spiegare l'origine e lo sviluppo della vita nel tempo, contraddica la termodinamica, la scienza della freccia del tempo.
 
Addendum - Obiezioni
 
Come lettura complementare, aggiungiamo alcune interessanti obiezioni e contro-obiezioni che vengono spesso sollevate nei dibattiti sui rapporti tra termodinamica ed evoluzione.
Obiezione n.1
C'è buona evidenza filosofica (al di fuori della fisica positivistica) che l'asimmetria del tempo non dipenda dall'entropia.
Risposta n.1
Secondo la cosmologia tradizionale la manifestazione è un dispiegarsi di possibilità che va dal polo essenziale (qualitativo) al polo sostanziale (quantitativo). L'universo è un processo che va verso il basso (una "discesa"). La termodinamica conferma questo dicendo che in un sistema l'entropia cresce globalmente in modo irreversibile. L'asimmetria del tempo segue l'asimmetria dell'entropia. Codesta a sua volta è basata sull'asimmetria dei due fondamentali principi cosmologici (Essenza e Sostanza). La superiorità dell'Essenza rispetto alla Sostanza conferma la spiegazione Intelligent Design dell'origine del cosmo. La discesa della manifestazione dalla Qualità alla Quantità è una specie di passaggio dall'ordine al disordine. Secondo quanto detto prima, considerando l'universo come un sistema globale, la SLOT afferma che l'universo va verso i suoi stati più probabili e disordinati (il massimo dell'entropia).
Obiezione n.2
Niente prova che c'è una discesa dalla Qualità alla Quantità. La Qualità non diventa mai Quantità.
Risposta n.2
Dire che la manifestazione è una discesa dalla Qualità alla Quantità non significa affatto che la qualità diventa quantità. Infatti questo è impossibile. Se qualità e quantità fossero convertibili il Progettista dell'universo non avrebbe avuto bisogno di due principi per formare il cosmo, sarebbe bastato uno solo. Invece entrambi furono necessari (come due strumenti). Nei termini della scienza e tecnologia moderne se la materia e l'energia (quantità) e l'informazione (qualità) fossero convertibili gli ingegneri non avrebbero bisogno di entrambi per costruire i loro sistemi. Nella discesa cosmica la qualità diminuisce e la quantità cresce, ma la qualità non diventa quantità. Pensiamo ad un bicchiere di vetro pieno d'acqua. Se beviamo l'acqua, il bicchiere diventa pieno d'aria ma ovviamente l'acqua non è diventata aria. I concetti di qualità e quantità e di "discesa" nella cosmologia tradizionale vanno d'accordo con le leggi della termodinamica (entropia, irreversibilità...). La termodinamica prova che in un processo l'ordine diminuisce e il disordine aumenta. La chiave di comprensione sono gli abbinamenti fra qualità e ordine e tra quantità e disordine.
Obiezione n.3
Ma forse i principi termodinamici non sono universali. Forse ci sono altri principi, principi del mondo vivente, che danno ragione della tendenza verso l'ordine biologico.
Risposta n.3
E` una vecchia illusione dei Darwinisti dire che in biologia ci sono eccezioni alla termodinamica che permettono l'evoluzione. Prima di tutto il fatto stesso che essi invochino eccezioni alla termodinamica li sbugiarda, perché ciò significa ammettere implicitamente che la termodinamica è contro di loro. Secondo, concettualmente eccezioni alle leggi naturali sono impossibili perché sarebbero eccezioni alla causalità (specificatamente alle cause seconde). Terzo, in pratica, tutti vedono che gli organismi consumano, trasformano e scambiano energia come tutti gli altri sistemi. Inoltre gli organismi degradano (più lentamente dei sistemi artificiali ma pur tuttavia degradano) e infine muoiono, come tutti gli altri sistemi. Per la cronaca la "lentezza" di disgregazione dipende dalla meravigliosa proprietà di auto-riparazione, che è basata su un numero incalcolabile di servo-meccanismi omeostatici progettati ad hoc di cui gli organismi sono pieni. Per cui quando i Darwinisti parlano di "principi del mondo vivente, che danno ragione dell'evoluzione verso l'ordine" stanno parlando di sogni. Essi sarebbero esattamente quelle eccezioni alla termodinamica che non possono esistere. Un'evoluzione verso l'ordine può essere pilotata solo dall'intelligenza. Tutti usiamo giornalmente l'intelligenza contro l'entropia quando pensiamo, scriviamo, calcoliamo, organizziamo, gestiamo, ordiniamo, strutturiamo, programmiamo e progettiamo cose. Senza l'intelligenza la termodinamica prende il sopravvento e le cose vanno solo verso il disordine.
Obiezione n.4
Sembra che l'intelligenza sia un'eccezione alla termodinamica. Ma se si ammette un'eccezione, perché scartarne a priori altre?
Risposta n.4
Dire che "l'intelligenza è un'eccezione alla termodinamica" è inesatto. L'intelligenza è una sorgente o un generatore di informazione. L'aumento di informazione corrisponde ad una diminuzione dell'entropia. In questo senso possiamo dire che l'intelligenza si oppone o contrasta l'entropia. Ma non possiamo certo dire che l'intelligenza interrompa o escluda le leggi della termodinamica. Semplicemente l'intelligenza è una componente o un attore dello scenario. Le leggi della termodinamica rimangono perfettamente funzionanti anche quando l'intelligenza agisce. Analogamente in un circuito elettronico l'introduzione di un generatore di corrente non interrompe le leggi dell'elettronica. Semplicemente il generatore di corrente fornisce corrente ad un circuito in cui era mancante. Allo stesso modo l'intelligenza fornisce informazione ad un sistema che manca di organizzazione.
Obiezione n.5
La termodinamica è attualmente una teoria statistica. In quanto tali, le sue predizioni sono puramente probabilistiche e non assolutamente certe.
Risposta n.5
Il fatto che la termodinamica sia una teoria statistica non comporta che i suoi teoremi non siano certi. In matematica il calcolo delle probabilità è pieno di teoremi certi che fanno previsioni.
Obiezione n.6
E` possibile che l'entropia diminuisca, ma è molto improbabile.
Risposta n.6
Quello che conta è la tendenza globale dell'entropia, che è crescente. E` questo a confutare il Darwinismo. La termodinamica dice che l'entropia (il disordine) crescono; siccome la macroevoluzione (cioè un aumento globale di complessità) comporterebbe un decremento complessivo dell'entropia, non può accadere spontaneamente.
Obiezione n.7
La termodinamica non è provata matematicamente. Essa è basata sull'evidenza empirica (che può essere fallace) come ogni altra teoria scientifica.
Risposta n.7
La branca della termodinamica che tratta della meccanica statistica dei sistemi composti da un gran numero di elementi è provata matematicamente e non è empirica. Essa prova che l'ordine decresce in modo spontaneo. La matematica è un esempio di teoria scientifica non basata sull'empirismo.
Obiezione n.8
E` solo un fatto empirico fallibile che ci sia un gran numero di elementi e che essi obbediscano a certe leggi.
Risposta n.8
Negare l'esistenza di "un gran numero di elementi" è negare la molteplicità. Le leggi termodinamiche sono una conseguenza della molteplicità. Negare la molteplicità significa negare la manifestazione, il cosmo e questo è assurdo.
Obiezione n.9
I.Prigogine ed altri hanno mostrato che l'ordine può crescere nei sistemi aperti nei quali la materia e l'energia possono entrare. La contestazione termodinamica del Darwinismo è quindi indebolita.
Risposta n.9
Matematici e fisici non sono d'accordo (vedi ad esempio i due articoli di G.Sewell in questo stesso sito, dove tratta dei sistemi aperti). Le loro conclusioni sono che i lavori di Prigogine non smentiscono la contestazione termodinamica dell'evoluzionismo. Se l'energia è in grado di creare novità biologica e tutt'oggi la terra riceve energia dal sole allora perché oggi non vediamo spuntare nuove specie? E` vero che Prigogine ha mostrato la nascita nei sistemi aperti di qualcosa che lui chiama "ordine", ma tale pretesa è esagerata. L'approccio di Prigogine ai sistemi aperti lontani dall'equilibrio termodinamico non prova niente al riguardo dell'origine della vita o dell'evoluzione. L'"ordine" di cui egli parla non è  il genere di ordine che la vita comporta. E` il problema base della comparsa di informazione complessa specificata (CSI) che non può essere risolto senza l'intervento dell'intelligenza.
Obiezione n.10
Le leggi della termodinamica sarebbero inapplicabili se il moto di ogni particella o molecola di un gas fosse accuratamente calcolato.
Risposta n.10
Ma il Neo-Darwinismo nega qualsiasi "guida" al processo evolutivo che è completamente cieco. Cosicché la  termodinamica si applica e smentisce il Neo-Darwinismo.
Obiezione n.11
Si possono trovare una mezza dozzina di leggi di natura sotto le quali l'entropia non cresce. Esempio 1: le molecole non interagiscono ma si muovono nella stessa direzione. L'entropia non cresce. Esempio 2: molecole newtoniane ma "appiccicose". Nel contenitore prima o poi sarebbero tutte incollate insieme. L'entropia non cresce.
Risposta n.11
Gli esempi addotti non sono "leggi di natura" ma casi artificiosi costruiti ad hoc. Nell'esempio 1 chi o cosa fa muovere tutte le molecole nella stessa direzione (non un compito facile!)? Nell'esempio 2 chi o cosa ha ... spalmato la colla sulle molecole? Sappiamo che in natura le cose non funzionano come in questi due esempi assurdi.
Obiezione n.12
L'apporto di energia può provocare una riduzione dell'entropia.
Risposta n.12
L'energia in ingresso può certo compensare l'energia in uscita. Ma l'apporto di energia non può accrescere o tantomeno creare l'ordine e l'informazione complessa biologica. Cosicché l'escamotage del "sistema aperto" non funziona. Inoltre se la terra è un sistema aperto rispetto al sole, entrambi formano un sistema praticamente chiuso, al quale si applica la termodinamica dei sistemi chiusi.
Obiezione n.13
Se la termodinamica confuta il Darwinismo, allora confuta pure il funzionamento interno degli organismi, e al limite proverebbe che non possiamo esistere.
Risposta n.13
Non vero. Il funzionamento interno degli organismi va perfettamente d'accordo con la termodinamica. L'energia assorbita con gli alimenti equilibra l'energia spesa. L'entropia (disordine) è controllata (entro certi limiti) dagli innumerevoli meccanismi progettati allo scopo. Quando tali limiti sono purtroppo superati e l'entropia è inevitabilmente fuori controllo i sistemi organici smettono di funzionare e alla fine interviene la morte biologica.
Obiezione n.14
La discussione circa l'energia, l'entropia e l'evoluzione (il problema dell'origine della vita) dovrebbe essere fatta nei termini dell'energia libera di Helmholtz e Gibbs: A = E - TS or G = H - TS; dove E è l'energia del sistema, H è l'entalpia, S è l'entropia e T la temperatura assoluta. Il criterio di spontaneità di una reazione chimica è in relazione alle variazioni dA e dG. In una reazione spontanea si ha dA <0 o dG <0. Le due funzioni implicano che un processo può essere spontaneo e disentropico, ammesso che la variazione di entalpia (o energia) sia sufficientemente favorevole.
Risposta n.14
La SLOT afferma che l'entropia totale = dS(sistema) + dS(ambiente) aumenta quindi la condizione globale è sempre dS(totale)>0. Ma che "distanza" c'è fra il livello chimico-fisico di base (al quale si applicano le suddette leggi fondamentali della chimica) e il livello della vita? Per darne un'idea conviene considerare l'analogia informatica. Il DNA contiene circa 750Mb, paragonabile ad un sistema operativo. Che distanza c'è fra l'algebra Booleana (o altre operazioni a livello di bit) rispetto ad un sistema operativo di computer? Entrambi "girano" sullo stesso computer. Gli informatici direbbero che tra i due ci sono molti "strati" o "livelli" software. In altri termini nel mezzo ci sono molti ordini, livelli o gradi di complessità. Analogamente il problema della vita non è semplicemente una questione di complessità ma di livelli o ordini di grandezza di complessità. Per convenzione potremmo dire che le leggi chimiche e fisiche fondamentali sono a livello 0. Esse sono semplici regole o istruzioni (software) che il cosmo (hardware) esegue. Potremmo dire che i composti ottenibili dalle reazioni chimiche sono a livello 1. Per esempio gli aminoacidi che S.Miller ottenne in laboratorio sono a complessità 1. Invece la vita è ad un livello di complessità N >> 1 (molto maggiore di 1). Miller era quindi molto distante dall'aver creato la vita in laboratorio. Se N è il livello di complessità del corpo umano e M è quello di un organismo unicellulare, già M >> 1.
Le leggi chimico-fisiche (livello 0) sono le cause del livello 1 (tutti i composti chimici semplici) ma non sono in grado di ottenere i livelli successivi. Indicativamente se gli aminoacidi sono a livello 1, le proteine (fatte di molti aminoacidi organizzati) sono a livello 2. Le proteine non si creano spontaneamente perché dal livello 2 in poi c'è bisogno di informazione complessa specificata (CSI). La SLOT "lavora" ovviamente ad ogni livello della gerarchia (stack); non c'è un livello sul quale vincere il disordine è più facile. La gerarchia della complessità è in fondo una gerarchia di informazione. Mentre l'intelligenza crea informazione, la SLOT la distrugge.
L'energia appare nell'equazione di Gibbs sotto forma di entalpia dH. Come tale aiuta a rendere la reazione chimica spontanea o no. Quindi l'energia è una specie di "catalizzatore" per la formazione dei composti chimici. Possiamo dire che "lavora" soltanto a livello 1. In questo senso abbiamo detto che l'energia non può creare informazione. Siccome l'informazione domina tutta la gerarchia fino alla sua cima e i composti chimici stanno a livello 1, l'energia da sola non giustifica la vita. Quando gli evoluzionisti dicono che "il sole creò la vita" essi vogliono proprio dire erroneamente che grazie ad esso la vita sulla terra è sorta e l'evoluzione si è sviluppata. Parafrasando G. Sewell possiamo dire: "Non vediamo venire dal sole né DNA, né biblioteche, né computer!". Il sole, e in generale l'energia, danno conto della vita solo come 1 sta ad N (per N >> 1). Ovviamente aumentando l'energia non si somma +1 tante volte fino ad arrivare ad N (perché "N" sono ordini di grandezza). Gli evoluzionisti confondono la materia e l'energia con l'informazione. Materia ed energia possono soltanto veicolare l'informazione. Ma veicolare informazione è completamente diverso dal generarla. Un foglio di carta può contenere un messaggio ma non può generarlo. Materia ed energia hanno solo un ruolo passivo rispetto all'informazione, perché sono solo al grado più basso della gerarchia dell'informazione.
Si può vedere la cosa anche da quest'altro punto di vista. Nell'equazione di Gibbs l'energia interviene nell'entalpia dH ma non nell'entropia dS. Ciò dice in altro modo che l'energia non può ordinare o organizzare. L'entropia è ciò che impedisce di avere gratis l'intero stack della complessità. Codesto, dal grado 0 al grado N deve essere progettato dall'intelligenza.
L'informazione non appare nell'equazione di Gibbs. Ma ovviamente essa permea tutto lo stack della complessità. L'entropia fisica dS ha la sua controparte nell'entropia dell'informazione. Sono le due facce della stessa moneta del disordine e della casualità. Possiamo vedere tale disordine sotto il suo aspetto fisico o quello informativo.
Prendiamo ora in considerazione l'evoluzionismo. Il Neo-Darwinismo afferma che tutto lo stack della complessità da 1 a N è dovuto alle mutazioni casuali e alla selezione naturale. In quanto tale è una meta-proposizione circa la formazione dell'intero stack. Il Neo-Darwinismo afferma che esso è dovuto al caso, che è sorto spontaneamente senza necessità dell'intelligenza. In altre parole esso pretende di avere la complessità gratis e la SLOT è ciò che lo impedisce. L'evoluzionismo pretende il cosiddetto "free lunch" ("pasto gratuito") e la SLOT è il "cassiere" che, come recita il titolo di un libro di Dembski, dice "no free lunch". Evoluzionismo e termodinamica sono matematicamente incompatibili.
Il "motore" evolutivo sarebbero le mutazioni casuali. Come dire: il caso genera ordine. La termodinamica: il caso genera disordine. Neo-Darwinismo e termodinamica dicono esattamente l'opposto. Ritorniamo alla metafora dell'informatica. Tutti gli informatici sanno che le "mutazioni casuali" nel software generano malfunzionamenti e spesso inchiodano il computer. Lo stack dell'informazione biologica è molto più complesso di quello dei computer. Le mutazioni casuali genetiche quando va bene sono inutili, quando va male - nella maggior parte dei casi - dannose. L'usuale obiezione dei Darwinisti è: ma c'è anche la selezione naturale. Sfortunatamente come si dice in informatica: "se ciò che entra è spazzatura, ciò che esce è spazzatura". Se il pre-processor delle mutazioni casuali da in input alla selezione naturale mutazioni dannose il post-processor della selezione naturale non può che dare in output danni.
Obiezione n.15
E`possibile che in speciali circostanze una zona di "brodo primordiale" possa aver avuto un abbassamento di entropia sufficiente per generare una "proto-vita", con un conseguente aumento compensativo dell'entropia nei dintorni.
Risposta n.15
Ciò che si chiama "proto-vita" in verità è molto vicino ad avere la complessità di grado M >> 1. Un semplice decremento locale dell'entropia non può certo raggiungere tale grado. Infatti è importante capire che, se un aumento di entropia significa distruzione di informazione, una diminuzione di entropia (neghentropia) non significa affatto creazione di CSI. La sorgente di CSI è sempre l'intelligenza. Detto in termini molto intuitivi: è più facile distruggere che costruire; fra costruzione e distruzione non c'è simmetria. I castelli di sabbia sulle spiagge sono di solito distrutti dall'entropia ma nessuno ha mai visto un castello di sabbia costruito dalla neghentropia!
Obiezione n.16
Asserire che mettere dei gradi in un "continuum" li rende magicamente reali non ha senso. E` proprio la tesi del Darwinismo che tali confini possono essere sormontati a piccoli passi. La vita non è così termodinamicamente improbabile da non poter sorgere in tempi geologici. La questione è se c'è il continuum Darwiniano. Per saperlo bisognerebbe investigare a livello atomico e quantistico.
Risposta n.16
Non è necessario investigare fino al livello atomico e quantistico per confutare il Darwinismo. E` forse necessario investigare le gates C-MOS dell'hardware di un computer per negare un'affermazione come questa: "tutto il software deriva da un processo casuale di generazione di bit"? Ovviamente no perché un software generato a caso è semplicemente impensabile. I programmatori lo sanno bene perché devono programmare loro stessi. La termodinamica generalizza tale constatazione ad ogni ambito. La SLOT è una legge semplice che è già in grado di confutare un errore grossolano come quello della macroevoluzione Darwiniana. I "piccoli passi" di cui sopra sono esattamente le mutazioni inutili o dannose. Come una somma di zeri (mutazioni inutili) o di numeri negativi (mutazioni dannose) non può dare un numero positivo, così le mutazioni inutili o dannose genetiche non possono generare vera complessità.
Obiezione n.17
E' termodinamicamente possibile lo sviluppo spontaneo di complesse forme viventi.
Risposta n.17
Per controbattere un'affermazione simile faremo riferimento al libro di B. Thaxton, Walter L. Bradley, Roger L. Olsen "The Mystery of Life's Origin" - specialmente i capitoli 7, 8 ,9.[20]
All'inizio del capitolo 8 "Thermodynamics and the Origin of Life" c'è il seguente paragrafo:
 
«(1) Peter Molton ha definito gli esseri viventi come "regioni di ordine che usano l'energia per MANTENERE la loro organizzazione contro le forze distruttive dell'entropia". (2) Nel capitolo 7 è stato detto che l'energia e/o la materia che entra nel sistema può portarlo distante dall'equilibrio [termodinamico], portando ad un aumento dell'ORDINE. (3) Quindi è termodinamicamente possibile che si sviluppino complesse forme di vita, presupponendo che il flusso di energia attraverso il sistema sia capace in qualche modo di ORGANIZZARE i semplici elementi chimici nelle complesse strutture necessarie alla vita»
 
Il solo commento di questo paragrafo ci permetterà di capire perché c'è l'equivoco e l'illusione evoluzionistica che un sistema aperto ricevente energia dall'esterno possa sviluppare la vita da materia inorganica (abiogenesi) o possa aumentare l'organizzazione di organismi preesistenti. Abbiamo numerato le frasi e scritto in maiuscolo le tre parole chiave: "MANTENERE", "ORDINE" e "ORGANIZZARE".
 
(1) La prima proposizione di P.Molton è corretta ma troppo sintetica. Sarebbe stato più esatto dire: "L'energia fa si che possano funzionare i meccanismi (progettati) che MANTENGONO l'organizzazione negli organismi"!
(2) La seconda proposizione è corretta ma dobbiamo accuratamente chiederci cosa significa la parola "ORDINE" in quel contesto. Certo significa una diminuzione di entropia. E` usuale in chimica e fisica identificare: "aumento di entropia = disordine" e "diminuzione di entropia = ordine". Ma di quale tipo di ordine si tratta? Ci sono molti tipi di ordine. "Ordine" è un termine qualitativo che non può essere semplicemente ridotto alla quantità. L'ordine delle molecole in un cristallo è completamente differente dall'ordine del DNA (che contiene informazione codificata). L'ordine del DNA è molto più qualitativo dell'ordine del semplice cristallo perché contiene più informazione. Il DNA ha un ordine che è gerarchicamente superiore a quello del cristallo. La diminuzione di entropia causata dall'energia non è in grado di generare quel tipo di ordine superiore contenuto nel DNA. L'ordine qualitativo del DNA è esattamente ciò che l'Intelligent Design Theory chiama CSI (Informazione Complessa Specificata).
(3) Quanto appena detto ci fa capire che la terza proposizione è sbagliata. Dire che "il flusso di energia attraverso il sistema è capace in qualche modo di ORGANIZZARE i semplici elementi chimici nelle complesse strutture necessarie alla vita" è errato proprio perché organizzare comporta della CSI, e la CSI è un tipo di ordine che l'energia da sola non può creare. Quindi è sbagliato dire che "è termodinamicamente possibile che si sviluppino complesse forme di vita" perché "lo sviluppo di complesse forme di vita" implica un grado di organizzazione che la sola energia non è in grado di dare. Invece sarebbe stato corretto dire semplicemente: "E` termodinamicamente possibile che l'energia introdotta nel sistema possa diminuire localmente l'entropia. Punto."
 
In definitiva la deduzione "diminuzione di entropia -> CSI" è sbagliata. Questo equivoco, che il paragrafo citato rappresenta assai bene, è la vera ragione dell'illusione evoluzionistica. Gli evoluzionisti, escludendo l'intervento dell'intelligenza, hanno bisogno di un suo sostituto, e non hanno altra possibilità che ricorrere all'energia (che non è all'altezza del compito). Questo equivoco è dovuto al fatto che non si fanno le necessarie distinzioni qualitative tra i molti tipi di ordine. (Ciò dipende da una concezione della scienza solo quantitativa e riduzionista). E` stato usato il pretesto dell'usuale definizione "diminuzione di entropia = ordine" per dedurre indebitamente che ogni tipo di ordine - anche quello più elevato - possa derivare dalla materia con il contributo dell'energia. Ma la qualità/essenza non può ridursi alla quantità/sostanza, e - viceversa - la quantità/sostanza non può convertirsi in qualità/essenza. La materia e l'energia sono quantità/sostanza e l'informazione/CSI è qualità/essenza.
La vita comporta un'enorme CSI, che l'energia non contiene. L'energia può diminuire localmente l'entropia ma ciò non causa CSI. Il sorgere della vita è un problema di partenza (potremmo chiamarlo "assoluto"). Sembrerebbe che l'origine delle specie viventi sia solo un problema "incrementale". Ma anche l'origine delle specie richiede CSI. Mentre il primo problema riguarda il sorgere di CSI dal niente, il secondo sembrerebbe partire da un CSI minore preesistente. Ma di fatto si tratta dello stesso problema: da dove arriva la CSI, chi la fornisce, cosa la crea? Quindi una confutazione dell'origine spontanea della vita (come quella qui illustrata) nega contemporaneamente anche il Neo-Darwinismo.
Obiezione n.18
L'energia può generare ordine.
Risposta n.18
Abbiamo detto che l'errore dell'"energia che genera la vita" è dovuto ad un'interpretazione troppo semplicistica della termodinamica e specificatamente del concetto di "ordine". "Ordine" è un termine che è entrato in fisica con la scoperta della termodinamica. "Ordine" ha molti significati come la parola "informazione" (ciò non è per niente strano perché sono strettamente in relazione). In un certo senso potremmo dire che l'informazione è entrata nella scienza non con Shannon ma ben prima, con Clasius e Boltzmann. E` entrata dalla porta sul retro della termodinamica prima di entrare dalla porta principale della teoria dell'informazione. Se vogliamo gli evoluzionisti hanno usato questo come cavallo di Troia per sostenere l'abiogenesi e il Neo-Darwinismo.
Sfortunatamente l'assunto termodinamico: "diminuzione di entropia = ordine" non è stato analizzato in profondità. Mentre la fisica ha investigato molto bene l'energia e ha trovato tutti (o quasi tutti) i suoi molti tipi, non ha investigato altrettanto bene le molte forme di ordine, anche perché l'ordine/informazione è l'oggetto di studio di altre scienze. (E comunque una scienza troppo a "compartimenti stagni" è difettosa.) Tutto ciò ha enormemente aiutato gli evoluzionisti nel sostenere i loro errori. Il loro semplice ragionamento è: "guardate l'energia che, diminuendo l'entropia, può aumentare l'ordine fino ad arrivare a quello della vita". Per essi il concetto di ordine è un semplice continuum dalla sue forme più semplici a quelle più alte. Quindi dobbiamo spiegare che esso è invece un concetto gerarchico essenzialmente discontinuo.
Esaminiamo alcune specie di ordine a livello microscopico. La seguente è una lista necessariamente semplificata che comunque può già dare un'idea.
 
(a)    L'ordine dei cristalli. Per esempio: quando l'acqua si trasforma in ghiaccio il sistema passa dallo stato disordinato dell'acqua (maggiore entropia) allo stato più ordinato dei cristalli di ghiaccio (minore entropia)
(b)   L'ordine dei sistemi a bassa entropia lontani dall'equilibrio di I.Prigogyne e altri.
(c)    L'ordine delle macromolecole come le proteine, gli acidi nucleici, RNA e DNA.
(d)   L'ordine dei processori delle suddette macromolecole, come i ribosomi e molte altre macchine cellulari.
(e)    L'ordine della cellula considerata come un sistema auto-sufficiente capace di auto-sopravvivere e auto-riprodursi (questo ordine sovrasta e gestisce gli ordini precedenti (c-d)).
 
Per gli evoluzionisti l'insieme da (a) a (e) - brevemente (a-e) - è un continuum ottenibile semplicemente da una diminuzione di entropia causata dall'energia. L'ordine (a-b) può sorgere spontaneamente grazie alle leggi naturali e al caso. Le leggi naturali contengono in se stesse la potenzialità di generare processi di tipo (a-b). Invece l'ordine (c-e) non può derivare soltanto dalle leggi naturali e dal caso. Le leggi naturali non hanno in se la potenzialità di creare sistemi di tipo (c-e). Secondo la teoria del disegno intelligente l'ordine (c-e) comporta CSI. Secondo l'Algorithmic Information Theory (AIT, G.Chaitin, M.Kolmogoroff) la CSI è informazione "incomprimibile", cioè non può essere sintetizzata in una forma o regola più semplice. Informazione incomprimibile come il DNA non può essere l'output di leggi naturali. Essendo essa incomprimibile le leggi naturali dovrebbero contenerla in se stesse in forma completa e noi sappiamo che non è così. Per esempio, prendiamo un piccolo pezzo di DNA come questo:  CTAGGCATCATGAAATAGGAACAAATCATTTAG ...
Nessuna legge della chimica o della fisica contiene tale sequenza, ne contiene la descrizione di tutte le altre macromolecole organiche. Siccome tali sequenze sono incompressibili, le leggi, che sono semplici algoritmi, non possono generarle. Nessun algoritmo più piccolo delle sequenze stesse è in grado di farlo.
Gli evoluzionisti possono obiettare: se le leggi sono impotenti forse il caso potrebbe generare le proteine e il DNA. Questo è impossibile: un processore che processa informazioni è un sistema gerarchico che non può sorgere grazie al "caso e la necessità". I livelli di ordine (d-e) sono processori.
Alcuni ipotizzano che qualche proteina (ordine di tipo ‘c') può essersi prodotta spontaneamente. Per quanto ne sappiamo nessuno è riuscito a farlo in laboratorio. Ma il punto chiave è il seguente: già le proteine hanno CSI perché contengono "codici" o "messaggi" che i livelli successivi (d-e) devono processare. Siccome un processore può interpretare messaggi solo se ne condivide la codifica (per esempio, noi scriviamo e voi leggete solo perché condividiamo la lingua italiana), una proteina funzionale deve "andare d'accordo" con il suo interprete e non può essere generata a caso. Cosicché è oltremodo probabile che quand'anche una proteina fosse generata a caso in laboratorio essa non sarebbe funzionale. Sarebbe perfettamente inutile come una qualsiasi sequenza casuale di caratteri.
Per riassumere la gerarchia degli ordini di complessità (a-e) ha i livelli (c-e) irraggiungibili dal caso e dalla necessità. La materia, l'energia, la diminuzione di entropia, le leggi naturali e il caso non possono raggiungere il regno della CSI. Speriamo di aver spiegato perché l'ordine è un argomento molto intricato e perché l'eccessiva semplificazione dei suoi molteplici significati, quando si parla di termodinamica, apre le porte agli errori degli evoluzionisti.
 
Come ha detto giustamente Roger Caillois "Clausius e Darwin non possono avere entrambi ragione". Questo è - in nuce - il vero motivo per cui la contestazione della termodinamica è letale per l'evoluzionismo.


[1] I.Prigogine, Le leggi del caos, cap.2.

[2] W.A.Dembski, Intelligent Design, cap.6.1.

[3] C.Shannon, A mathematical theory of communication, The Bell System Technical Journal, Vol.27.

[4] O.C.De Beauregard, Le second principe de la science du temps - Irréversibilité, Entropie, Information, cap. III, 16.

[5] W.H.Zurek, Algorithmic randomness and physical entropy, Physical Review, Vol.40, N.8, October 15, 1989.

[6] L.Brillouin, Science and Information Theory.

[7] N.Wiener, Cybernetics, Introduction

[8] M.Gell-Mann,Il quark e il giaguaro, cap.16.

[9] V.Silvestrini, Che cos'è l'entropia, cap. III.

[10] R.Jastrow, Il telaio incantato, cap.1.

[11] D.Raffard de Brienne, Per finirla con l'evoluzionismo, III,4.

[12] F.Cramer, Caos e ordine, cap.1.

[13] J.Monod, Il caso e la necessità, cap. VII.

[14] S.J.Gould, L'evoluzione della vita sulla terra, Le Scienze quaderni, n.98.

[15] R.Dawkins, Il cappellano del Diavolo, cap.2.

[16] J.Monod, Il caso e la necessità, cap. VII.

[17] G.Nicolis, I.Prigogine, Exploring complexity, 4.7.

[18] G.Mangiarotti, Dai geni agli organismi, cap.2.

[19] Ilya Prigogine, La Nouvelle Alitarne - Métamorphose de la science.

[20] http://www.ldolphin.org/mystery/index.html